Choose the correct translation of the following time.

6:15

A. Son las seis y cuarto.
B. Son las seis menos cuarto.
C. Es las seis quince.
D. Es las seis y cuarto.

Answers

Answer 1

Answer:

A.Son las seis u cuarto

Explanation:

Because Son las seis y cuarto is *6:15* and son las menos cuarto is *5:45*

I hope this helped!

Answer 2

Answer:

A. son Las seis y cuarto

Explanation:

hope this helps


Related Questions

Fill in the blank La _____ es una frusta Rohan y penquena y va bien con el cereal

Answers

Answer:

Fill in the blank: La fresa es una fruta Roja y penqueña y va bien con el cereal

Explanation: Common sense fresa = strawberry, la fresa es una fruta pequeña y se ilustra muchas veces en portadas de cereales.

Answer:

strawberry=fresa

Explanation:

Test approved

Which country is on the largest island in the Caribbean ?

Answers

Answer:

Cuba

Explanation:

The country that is the largest island in the Caribbean is:

Cuba

The answer is Cuba , is the largest

Only answer if u do flvs
Listen and choose the correct option.



Based on the audio, what could be one adjective that describes Elena?

She is athletic.
She is creative.
She is artistic.
She is shy.

Answers

Answer:

2

Explanation:

Answer:

Athletic

Explanation:

el libro _____
1. amarillo
2. marrónes
3. blanca
4. azulo

Answers

Answer:

1. amarillo

Explanation:

El libro amarillo.

Is my work correct or no ?

Answers

it’s correct !!!!!!!!!!!!!!!!!!!

Answer:

yes it is

Explanation:

Please help me answer 25. Please

Answers

a. los lápices
b. las narices
c. los profesores
d. los ratones
a) los lapizes
b) la narizes
c) el profesores
d) el ratones

qué es lo más característico de la literatura del renacimiento en España.

Answers

Answer:

Las características de la poesía renacentista fueron el ingenio, la belleza y la verdad. Los poetas utilizaron la repetición para enfatizar sus temas. Shakespeare fue el maestro del género dramático durante el Renacimiento. Sus habilidades en la caracterización y la creación de palabras fueron evidencia de su genio.

son las cinco _ la tarde

Answers

Answer:

de is the naswer

Explanation  :son las cinco _de  la tarde

Answer:

de

Explanation:

Son las cinco de la tarde.

¿Como Microsoft Exel puede facilitar tu trabajo en la escuela y en tu vida diaria

Answers

Answer:

Microsoft Exel puede facilitar tu trabajo en la escuela y en vida diaria:

1.Organizar los datos, ya sean numéricos o de texto, en hojas o libros de cálculo.

2.Aplicar formatos para ver los datos en contextos que te ayuden tomar decisiones.

3.Ordenar la información de la forma en que lo necesites.

4.Realizar búsquedas dentro de los datos que introduzcas.

Help me out pleaseeeee

Answers

Answer:

the answer is Ella es de cuba. Have a nice day!

todas los tipos de dinero
en efectivo que se han creado a través de la historia en Colombia

Answers

Answer:

Explanation:

Spanish: Todas los tipos de dinero

en efectivo que se han creado a través de la historia en Colombia

English: All types of money

in cash that have been created throughout history in Colombia

Fill in the blank in the following sentence with the appropriate verb in the
conditional tense.
Si pudiera, yo
todas las noches.
A. salió
B. saldré
C. saldria
D. salía

Answers

The correct answer is C. Saldria

IV. Describe the important geographical features of where you live or of a place you like. Use
as much of the new vocabulary as you can and look up a few words if necessary. This can
include geographical location (north, south, east, west, etc.). Write at least four sentences. (16
points; 4 points each)

I live in the west side of Massachusetts if that helps your answer. I guess just describe things that could be anywhere?

Answers

Answer: Yo vivo al este de Massachusetts. Me gustan los arboles que hay alrededor y como los humanos pasean a sus perros por la mañana y por la tarde. Por la noche hay muchas luces y me gusta que la ciudad se ve muy viva y alumbrada.

Explanation:

The boy is tall. The girls are smart. The boy is short. The girls are pretty. El chico es bajo. Las chicas son bonitas. El chico es alto. Las chicas son inteligentes. Drag & Drop! C​

Answers

El chico es alto
Las chicas son inteligentes
El chico es bajo
las chicas son bonitas

Answer:

Blue is the third one

red is the first one

orange is the last one

green is the second one

Where is Machu Picchu located?

Answers

Answer:

Explanation:

In the Andes Mountains in Peru.

In Peru !! It is located

Empareja la frase con el verbo correcto. Pair the sentence with the correct verb. (4 points)


1.
A la casa le ________ los azulejos típicos de la arquitectura mudéjar.


2.
Las tapas les ________ por dos o tres personas.


3.
Las aldeas de Argentina me ________ como las de España.


4.
Nos ________ los vegetales de temporada más que la ensalada.
a.
bastan
b.
parecen
c.
agradan
d.
faltan
Spanish speakers only plz

Answers

1. faltan
2. bastan
3. parecen
4. agradan

hey guys so dadadada, yes i did that

Answers

Answer:

Spanish traslation:

Hey chavos, dadadada, si, yo lo hice

que conclusiones y enseñanzas para la vida de los seres humanos podriamos sacar de la parabola de los gansos ?

Answers

En la parábola del ganso podemos concluir que si queremos recorrer los caminos solos encontraremos mucha resistencia, pero en grupo el camino a recorrer es más sencillo.

¿Qué dice la parábola del ganso?

Cada vez que un ganso sale de la formación, de repente siente el esfuerzo y la resistencia necesarios para seguir volando por su cuenta. Rápidamente vuelve a entrar en formación para aprovechar el desplazamiento de aire causado por el pájaro que vuela inmediatamente frente a él".

With this information, we can conclude that Las personas que comparten una dirección común y un sentido de comunidad pueden lograr metas más fácilmente. Para lograr nuestros objetivos, es necesario estar junto a quienes van hacia donde queremos ir, dando y aceptando ayuda.

Learn more about comunidad in brainly.com/question/21405984

#SPJ1

1. Como de Han formado los generos musicales cubanos?

Answers

Answer:

The Music of Cuba

Explanation:

Cuba developed a wide range of nested musical styles, based on its Spanish and African cultural origins. Since the 19th century, Cuban music has enjoyed enormous popularity and influence, becoming one of the most popular forms of music in the world. Cuban music has its main roots in Spain and West Africa, but over time it has been influenced by various genres from different countries. Among these, France and its colonies in Latin America and the United States states.

6. Los chicos _________ en la clase.
7. Nosotros ________ en la cafetería.
8. Tú ________ debajo de la cama. ¿Por qué?

Answers

6. Están
7. Estamos
8. Estas

20 POINTS!! *WILL MARK AS BRAINLIEST!!*
SPANISH PROS- THIS ONES FOR U
I NEED QUESTIONS 5 AND 6 DONE ASAP!!
Its literally so easy- but i'm just procrastinating and i have to finish a bunch of other stuff- it would be a great help :)

Answers

I attached a screenshot of the answers. Hope this helps!

Tell me if you need more positive and negative answers.

1. La camiseta está en la mochila y Pablo no tiene la mochila. 2. Pablo y Claudia hablan con Roberto. 3. Claudia y Pablo van a la biblioteca y estudian. 4. Pablo está nervioso; tiene que ir al gimnasio a las cinco. 5. Pablo va a la clase de ciencias y no contesta la pregunta.

Answers

I don’t get what I’m supposed to do here they’re just a few sentences.
1. The T-shirt is in the backpack and Pablo doesn't have the backpack. 2. Pablo and Claudia talk to Roberto. 3. Claudia and Pablo go to the library and study. 4. Paul is nervous; he has to go to the gym at five. 5. Pablo goes to science class and doesn't answer the question.

PLESSEEEEE HELP ASAPPPPPP

Answers

Answer:

36 tienes

37 somos

38 tenemos

39 tiene

40 tiene

Juan ________ el traje negro. Él y su hermano Esteban ________ los pantalones y la camisa azul para la boda de su tío. (1 point)
se quita; nos ponemos
se quitan; nos ponemos
se quitan; se ponen
se quita; se ponen

Answers

Juan “se quita” el traje negro. El y su hermano esteban “se ponen” los pantalones y la camisa azul para la boda de su tío.
Juan se quita el traje negro. El y su hermano Estaban se ponen los pantalones y la camisa azul para la boda de su tío
( se quita; se ponen ) last option ! :)

C) ¿cómo a través de la vivencia de los 7 hábitos es posible consolidar su PROYECTO DE VIDA y evitar los aspectos negativos que tiene la globalización en su proyecto de vida?

Answers

La respuesta correcta para esta pregunta abierta es la siguiente.

Aunque no mencionas a qué "7 Hábitos" te refieres, porque no incluyes textos o referencias, podemos interpretar que hablas del libro "Los 7 Hábitos de la Gente Altamente Efectiva," escrito por Stephen Covey.

Si es así, entonces podemos responder de la siguiente manera.

A través de la vivencia de los 7 hábitos, es posible consolidar un PROYECTO DE VIDA y evitar los aspectos negativos que tiene la globalización porque estaremos creando la serie de buenas costumbres y hábitos que indica el autor, pero ajustándolos a nuestras propias condiciones, necesidades y características.

Hábitos recomendados como el "ser productivo," "tener un objetivo en mente," "establecer prioridades," "comprensión, "y "mejora continua," nos ayudan a construir un proyecto de vida exitoso, en donde el trabajo, la dedicación y las buenas costumbres profesionales enfocadas a nuestro región o localidad.

Evitaremos caer en la tentación de globalizar las actividades que deberían centrarse en atender las necesidades internas o locales, para generar las condiciones económicas que nos ayuden a fortalecer el crecimiento interno, en beneficio de la comunidad.

help translate to english then answer the questions



2. in the three-level altar what objects do they put on the underworld level

3. What objects do thsy put on the level of earth

4.What objects do they put on the level of heaven

5. why do they also put candles and sugar skulls in all the levels. ​

Answers

Answer:

2. flores de color violeta, incienso de copal, agua y una cruz

3. foto de un muerto, objetos personales, las comidas y bebidas favoritas del muerto, flores de cempasúchitl y pan de muerto.

4. ponen velas y calaveras de azúcar en todos los niveles porque las velas ayudan a los muertos a encontrar sus casas y las calaveras representan la muerte y confirman que la muerte esta presente en todas partes

Answer:

2:Flores de color violeta, incienso de copal, agua y una cruz.

3:Foto del difunto, objetos personales, comida y bebida favoritas de el difunto, flores de cempaxúchitl y pan de muerto

4:Papel picado y flores blancas.

5:Las velas son para ayudar a los difuntos a encontrar el altar, y  las calaveras de dulce son para confirmar que la muerte se encuentra en todos lados

Explanation:

Qué significa los siguientes conceptos: disciplina

Answers

La disciplina es una acción o inacción que está regulada de acuerdo con un sistema particular de gobierno. La disciplina se aplica comúnmente para regular el comportamiento humano y animal en su sociedad o entorno al que pertenece.

QUICK! 25 POINTS!
Select the plural negative command that best completes the sentence.

_____ galletas.

No comen
No comes
No coman
No comes

Answers

Answer:

No coman galletas

Explanation:

Fill in the blank in the following sentence with the appropriate verb in the
conditional tense.
Si pudiera, yo
todas las noches.
A. salió
B. saldré
C. saldria
D. salía
A. Salio

Answers

Answer: a

Explanation: when you conjugated a verb to I (yo) then last letters are taken out and replaced with o. So the answer is salio.

The correct option to fill the sentence in Spanish, using the conjugation of the verb in Conditional Tense is: "saldría."

Conditional Tense in Spanish

The conjugation of the verb "salir" in conditional tense, taking into account the personal pronouns is:

Yo: saldríaTú: saldríasUsted: saldríaÉl: saldríaElla: saldríaEllo: saldríaNosotros / Nosotras: saldríamosUstedes: saldríanEllos / Ellas: saldrían

To identify the appropriate conjugation in each sentence, you must identify the noun in the sentence, replace it with the appropriate personal pronoun, and finally use the corresponding conjugation with the help of the guide above.

If you want to learn more about Conditional Tense in Spanish, you can visit the following link: https://brainly.com/question/23122830

#SPJ2

Empareja la civilización con la descripción apropiada. Match the civilization with the appropriate description. (4 points)


1.
los árabes quienes conquistaron a España y todavía tienen influencias profundas en el arte, cultura, lenguaje y arquitectura


2.
el imperio indígena que influyó a los países de los Andes


3.
civilización yucateco que tiene en la familia de lenguajes el quiché


4.
En México hay muchos dialectos nativos que vienen de náhuatl y edificaron templos de pirámides.
a.
El imperio maya
b.
Una civilización inca
c.
Los aztecas
d.
Los moros
plz help spanish speakers or people who know the answer 50 points!!!!!!!
plz dont answer if you don't know I really need this

Answers

Answer:

1.los árabes quienes conquistaron a España y todavía tienen influencias profundas en el arte, cultura, lenguaje y arquitectura= D los moros

2.el imperio indígena que influyó a los países de los Andes= C

3.civilización yucateco que tiene en la familia de lenguajes el quiché= B

4.En México hay muchos dialectos nativos que vienen de náhuatl y edificaron templos de pirámides.= A

im spanish :)
1. moros
2. los mayas
3.los aztecas
Other Questions
Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s