Particle
Proton
Neutron
Electron
Charge
A =
+1
0
-1
Location
Nucleus
Nucleus
Orbitals
Approximate
mass (amu)
1
1
0
Made of
quarks?
A
B
00
C
Complete the table to summarize the properties of the different subatomic particles by typing in "yes" or
"no."

Answers

Answer 1

Charge on neutron, proton and electron is 0,1,-1 respectively, proton and neutrons are in nucleus while electron are in orbitals, the mass of electron is nearly 0 while mass of proton and neutron is 1 amu and only proton and neutrons are made up of quarks.

Electron, neutron and proton, all three are sub-atomic particles.

The charge on Neutron is 0.

The charge on Electron is -1.

The charge on Proton is +1.

Protons and neutrons are found inside the nucleus because they only are forming the nucleus, this is why they are also called Nucleons.

The electrons are found in the orbitals.

Approximate mass of Proton and Neutron is 1 amu. But the electron is very very light as compared to electron. So, we can assume it to be zero.

Protons and Neutrons are made up of Quarks but electron is not made up of quark.

Electron and Quarks are the fundamental particle in an atom.

To know more about Sub-Atomic particles, visit,

https://brainly.com/question/28763045

#SPJ9


Related Questions

What mass of HCI is needed to
generate 45.2 g of AICI3?
2AI + 6HCI → 2AlCl3 + 3H₂
AICI3: 133.33 g/mol
HCI: 36.46 g/mol

Answers

Answer:

37.1g of HCl

Explanation:

rate as brainliest

an arctic weather balloon is filled with of helium gas inside a prep shed. the temperature inside the shed is . the balloon is then taken outside, where the temperature is . calculate the new volume of the balloon.

Answers

When the balloon is taken outside where the temperature is –9 °C, then the final volume becomes 19.3 L

From the question given above, the following data were obtained:

Initial volume (V₁) = 20.9 L

Initial temperature inside the shed (T₁) = 13 °C = 13 + 273 = 286 K

Final temperature inside the shed (T₂) = –9 °C = –9 + 273 = 264 K

As we know pressure remains constant so Pressure = constant

The final volume (V₂) =?

By using the Charles law equation, we can obtain the final volume i.e. V₂

[tex]\frac{V1}{T1}[/tex]  =  [tex]\frac{V2}{T2}[/tex]

[tex]\frac{20.9}{286}[/tex]  = [tex]\frac{V2}{286}[/tex]

Now cross multiply both sides

V₂ × 286 = 20.9 × 264

V₂ × 286 = 5517.6

Divide by 286 on both sides of the equation

[tex]V_{2}[/tex] = [tex]\frac{5517.6}{286}[/tex]

V₂  = 19.3 L

If you want to learn more about volume click here:

https://brainly.com/question/28795033

#SPJ4

The complete question is:

An arctic weather balloon is filled with 20.9L of helium gas inside a prep shed. The temperature inside the shed is 13 degrees C. The balloon is then taken outside, where the temperature is -9 degrees C. Calculate the new volume of the balloon. You may assume the pressure on the balloon stays constant at exactly 1 atm. Round your answer to significant digits.

why do you like homo and heterogen mixtures?

Answers

Homogeneous are hard to seperate but heterogeneous are easy to seperate.

What role does heterogeneous mixture have in daily life?

Every day, humans employ heterogeneous mixes that can be found all around them. Particles in heterogeneous mixtures can be recognized after mixing and still maintain their chemical characteristics. Filtration and chemical processes can be used to separate the components of heterogeneous mixes.

All substances exist in one state of matter, which is a homogenous mixture. Solids can combine uniformly with other solids, liquids can combine with other liquids, and so on.

On the other hand, a heterogeneous mixture (derived from the Greek word "hetero" for dissimilar) has a non-uniform composition, which means that different parts may contain more or less of a given component. A heterogeneous mixture allows for the simultaneous existence of solid, liquid, and gas phases as well as other states of matter.

To learn more about

heterogeneous mixture refer

https://brainly.com/question/24898889?

#SPJ13

experimentally, it is found that 3.4 moles of a molecule in gaseous form requires the addition of 454 j of energy at constant volume in order to raise its temperature by 8.4 k. calculate the molar heat capacity at constant volume for this gas.

Answers

The molar heat capacity at a constant volume for this gas is 15.90 J/(K⋅mol) if 3.4 moles of this gas require 454 j of energy to raise its temperature by 8.4 k.

The molar heat capacity can be calculated by using the formula;

molar heat capacity = C / n

where C represents the heat capacity

n represents moles

The heat capacity of this gas can be calculated as follows;

heat capacity = E / T

here, E represents the amount of heat energy supplied

T represents the change in temperature

Substituting the given values in the heat capacity formula;

heat capacity = 454 / 8.4

heat capacity = 54.05

Now we substitute this calculated value of heat capacity in the formula of molar heat capacity;

molar heat capacity = C / n

molar heat capacity = 54.05 / 3.4

molar heat capacity = 15.90

Therefore, the molar heat capacity for this gas at constant volume is calculated to be 15.90 J/(K⋅mol).

To learn more about the molar heat capacity, click here:

https://brainly.com/question/21326224

#SPJ4

An atom of Gold contains 120 neutrons. What is its mass number?

Answers

Answer:

199

Explanation:

Au has atomic number of 79

so mass number = 79 + 120 = 199

the reaction 2a → a2​​​​​ was experimentally determined to be second order with a rate constant, k, equal to 0.0265 m–1min–1. if the initial concentration of a was 3.75 m, what was the concentration of a (in m) after 180.0 min?

Answers

Based on the integrated equation used for reactant concentration calculation in a second-order reaction and the data given (initial concentration, reaction rate constant, and time elapsed), the concentration of A after 180.0 min will be 0.20 M.

The integrated equation for the reactant concentration in a second-order reaction looks like this:

1/[A] = kt + 1/[A]₀

k - reaction rate constant (0.0265 min⁻¹M⁻¹)

[A]₀ - initial concentration (3.75 M)

t - time elapsed (180.0 min)

1/[A] = 0.0265 min⁻¹M⁻¹ * 180.0 min + 1/(3.75 M) = 4.77 M⁻¹ + 0.27 M⁻¹ = 5.04 M⁻¹

[A] = 1 / (5.04 M⁻¹) = 0.20 M

You can learn more about second-order reactions here:
brainly.com/question/12446045

#SPJ4

Argon is one of the six noble gases, a group of elements that are known to be nonreactive. Explain why Noble Gases such as argon are nonreactive. Provide evidence from the model you drew in Question 1 to support your response.

Answers

The noble gases are known to be nonreactive because they have an already filled outer electron shell.

What are noble gases?

The noble gases is defined as those elements that are located at the group 8 of the periodic table which are also called inert gases.

Examples of six noble gases include the following:

Helium (He), Neon (Ne),Argon (Ar),Krypton (Kr),Xenon (Xe), and Radon (Rn).

The features of noble gases include the following:

They are odorless gases.They are non-flammable gases.Their melting and boiling points are close together giving them a very narrow liquid range.They are colourless gases. They are monoatomic gases with low chemical reactivity; andThe noble gases are called inert gases because they are non reactive gases.

The noble gases are non reactive because the outer atomic shells of these gases are filled up that is to say that they have a full Valence electron shell.

Learn more about noble gases here:

https://brainly.com/question/22266671

#SPJ1

a student is running an experiment in which 42.0 grams of coso4 is needed, but the only jar of reagent in the lab is labelled cobalt(ii) sulfate hexahydrate. how many grams of the hydrate must the student weigh out in order to get the desired amount of the anhydrous compound?

Answers

A mass of 71.26g of [tex]CoSO_4.6H_2O[/tex] is required to get 42g of the anhydrous compound, i.e., [tex]CoSO_4[/tex].

A compound's molar mass indicates the mass of one mole of that substance. In other words, it informs you how many grams of a substance there are per mole. A covalent compound's formula mass is also known as its molecular mass. The mole is a useful quantity unit for representing very large quantities of atoms or molecules. A substance's molecular mass is the total of the atomic masses of all the atoms that comprise the molecule of the substance.

The term anhydrous means "without water." Anhydrous chemicals are compounds that do not contain water or do not contain water. An anhydrate is formed when water is removed from a hydrate. Suction or high-temperature heating of the chemical removes the water molecules. An anhydrous salt, for example, has had water driven out of its crystals.

Given:

Mass of [tex]CoSO_4[/tex] needed = 42g

To find:

Mass of [tex]CoSO_4.6H_2O[/tex] = ?

Formula:

Mass of [tex]CoSO_4.6H_2O[/tex] = (Mol. Wt. of [tex]CoSO_4.6H_2O[/tex] / Mol. Wt. of [tex]CoSO_4[/tex]) x Mass of [tex]CoSO_4[/tex]

Calculations:

Mol. Wt. of [tex]CoSO_4[/tex] = 155g/mol

Mol. Wt. of [tex]CoSO_4.6H_2O[/tex] = 155 + 6 x 18 = 263g/mol

Mass of [tex]CoSO_4.6H_2O[/tex] = (263 / 155) x 42

Mass of [tex]CoSO_4.6H_2O[/tex] = 71.26g

Result:

71.26g of [tex]CoSO_4.6H_2O[/tex] is required to get 42g of the anhydrous compound.

Learn more about Mass of an anhydrous compound here:

https://brainly.com/question/8916538

#SPJ4

Match the structural formulas given to you below with the correct chemical formula from the bank above. (Image provided)

Answers

1) C3H6O because there are 6 hydrogen in formula and one oxygen. 2) H2So4 sulphric acid.  

What three categories exist for chemical formulas?

Chemical formulas can be divided into three categories: empirical, molecular, and structural. Molecular formulas display the quantity of each type of atom in a molecule, while structural formulas display the simplest whole-number relationship between the atoms in a compound. Empirical formulas display the simplest whole-number relationship between the atoms in a compound.

3) C2H2 ethyne where carbons have triple bond.

4) CO carbon monoxide where C and O have triple bond between them  .

5) HNO3 is nitric acid .

6) CH2F2

7) Ch2O

8) C2H4 is ethene in which carbon carbon have double bonds.

9) SO3 sulphur trioxide.

10) CH3F

To learn more about chemical formula refer

https://brainly.com/question/11995171?

#SPJ4

a 30.84 ml volume of 0.128 m naoh is required to reach the phenolpthalein endpoint in the titration of a 5.441 g sample of vinegar. calculate the percent acetic acid in the vinegar.

Answers

The percentage of acetic acid in vinegar is 4.36%

What is acetic acid?

The scientific name for acetic acid is ethanoic acid. It is an acidic, colorless liquid organic substance having the formula CH3COOH. Vinegar has a minimum of 4% acetic acid by volume, making acetic acid the primary component of vinegar besides water and trace elements.

Given,

Volume=  30.84 ml

Moles= 0.128

mass of vinegar= 5.441g

moles NaOH = 0.03084 ml x 0.128

M=0.00395

mass acetic acid = 0.00395 mol x 60.05 g/mol=0.237 g

Percentage of acetic acid:

= 0.237 x 100/ 5.441

= 23.7/5.441 = 4.36%

Hence, The percentage of acetic acid in vinegar is 4.36%

To learn more about percentage problems the link is given below:

https://brainly.com/question/14356148?referrer=searchResults

#SPJ4

What is the lithosphere? ) (25 pts)

Answers

The rigid outer part of the earth, consisting of the crust and upper mantle.

why would air moving over a cold current cause fog (advection fog)? group of answer choices the cold current produces the fog when kelp beds release condensation nuclei. all of the other answers are correct, and thus this is the best answer the cold current produces the fog by mixing with the air. the air is chilled, which decreases the capacity of air to hold water vapor, and eve

Answers

The correct answer is option  C.

The air moving over a cold current cause fog or advection fog when the air is chilled, which decreases the capacity of air to hold water vapor, and eventually, the relative humidity reaches 100% - leading to condensation and fog formation.

What is advection fog?

When warm- moist air or warm air front slides over the cold air front or cold surface, it results in the formation of advection fog.

Resultantly, the air becomes saturated and chilled at high humidity levels due to which water vapors start to condense leading to fog formation.

Moreover, the optimal condition for the formation of advection fog is cloudy windy weather having moderate to powerful winds.

If you want to learn more about advection fog click here:

https://brainly.com/question/18803983

#SPJ4

The complete question is:

Why would air move over a cold current cause fog (advection fog)?

(a)  the cold current produces the fog when kelp beds release condensation nuclei.

(b)  the cold current produces the fog by mixing with the air.

(c) the air is chilled, which decreases the capacity of air to hold water vapor, and eventually, the relative humidity reaches 100% - leading to condensation and fog formation.

A student measures 25ml of acid into the flask and adds the 3 drops of the indicator. if the student then adds 20ml of water to the flask, will this change to amount of base needed to reach the endpoint?

Answers

The addition of water to the acid solution will change the molarity of the solution, but not the amount of base needed to reach the titration endpoint because the total amount of acid hasn't changed.

During this titration, a solution of the base will be added to a solution of the acid, and when the endpoint is reached, the indicator will change color. The titration endpoint is reached when the acid in the sample solution has been completely neutralized, and an excess base is now appearing.

The amount of base required for neutralization is determined by the amount (number of moles) of acid in the starting solution. Although the starting solution would become more dilute (lowering its molarity) upon the addition of water, the total amount of acid will not be reduced, thus requiring the same amount of base.

You can learn more about molarity here:
brainly.com/question/16727614

#SPJ4

Look at the two waves shown. What is the speed of each wave?

Answers

The speed of all electromagnetic waves is equal to the speed of light that is 3 × 10⁸ m/s.

What is an electromagnetic wave?

An electromagnetic wave is a wave of certain wavelength of an electromagnetic radiation of the electromagnetic spectrum. There are different types of waves in the spectrum like IR, radio waves etc.

The speed of c of the wave is the product of its frequency and wavelength. The speed of all electromagnetic waves are equal to the speed of visible light.

Hence, the speed of both waves is 3 × 10⁸ m/s.

To learn more about the electromagnetic waves, refer the link below:

https://brainly.com/question/3101711

#SPJ1

1. using your titration data, calculate the %na2co3 for each trial, the average %na2co3 and standard deviation. 2. describe how to obtain a second derivative plot. 3. why is potentiometry used to detect the endpoints for this titration? could color indicators have been used?

Answers

Simply subtract the differences in the first derivative values from the differences in the midpoint volumes to obtain the second derivative, and then plot this value at the intersection of the two midpoint volumes.

Potentiometric titration is a laboratory method to determine the concentration of a given analyte.

Na2CO3 and NaHCO3 concentration in a mixture can be determined by accurately weighing 2.0 g of the mixture and making a distilled water solution in a 250 ml standard flask. Use phenolphthalein as an indicator while you gradually titrate 25 ml of this solution against regular hydrochloric acid. To concord, repeat (Vp ml).

In order to locate the equivalency more precisely, a second derivative plot is also generated. point—where the extrapolated line intersects the x-axis (graph 4). A highly precise value for the volume of titrant can be acquired because the x-axis indicates the volume of titrant utilized.

Potentiometric titration is one of the chemical methods of analysis, and it involves adding a titrant with a known concentration and measuring the endpoint of the titration with an indicator electrode that records the change in potential as a function of the amount (often the volume) added.

To learn more about Potentiometric titration visit:https://brainly.com/question/28855227

#SPJ4

Why does H2O(s) floats on H20(l) when both are at 0c

Answers

H2O(s) floats on H2O(l) when both are at 0°c because ice is lighter than water which causes water to displace ice.

The density of a substance is calculated by the ratio of the mass of the substance to the volume of the substance.

Ice structure is cage like with more intermolecular spacing and Hydrogen bonds are stable. Water structure is linear and Hydrogen bonds form and reform. It causes more volume for same mass in ice and less volume for same mass in water.

At 0°C the density of ice is less than density of water. At 0°C, density of water is 1.0 gm/cm³ and density of ice is 0.931 gm/cm³, so water causes ice to displace resulting in ice floating over the water.

Learn about the relation between volume and density of ice and water at:

https://brainly.com/question/11184327

#SPJ1

several properties of water are shown classify the ones that are phycical propertys
and the chemical propertys

Answers

Water's physical characteristics include its liquid state at ambient temperature and density of 1.0 g/cm3. Water has the ability to divide into hydrogen and oxygen and react with some metals, among other chemical features.

Phycical  and Chemical PropertysA substance's physical property is a quality that can be seen or quantified without affecting the substance's identity. Color, density, hardness, and melting and boiling points are examples of physical qualities. The capacity of a substance to go through a particular chemical transition is described by its chemical property. An attribute of a specific material that can be seen in a chemical reaction is called a chemical property. Major chemical characteristics include chemical stability, flammability, toxicity, heat of combustion, pH value, and rates of radioactive decay.

To learn more about Phycical and Chemical Propertys refer:

https://brainly.com/question/1733027

#SPJ13

cheggin the experiment to determine which mechanism was used by restriction endonucleases, what evidence ruled out the formation of a covalent intermediate?

Answers

The covalent phosphodiester bonds of DNA are hydrolyzed by restriction enzymes, leaving either "sticky/cohesive" ends or "blunt" ends.

By incubating the target DNA molecule with restriction enzymes, which detect and bind certain DNA sequences and cleave at specified nucleotides either inside or outside of the recognition sequence, restriction digestion is carried out.

An isolated bacterial protein known as a restriction enzyme cleaves DNA at sequence-specific locations to create DNA fragments with a known sequence at either end. Restrictions enzymes are crucial for numerous laboratory processes, including recombinant DNA technology and genetic engineering.

At the particular restriction site, DNA bonds between the 3′ OH of one nucleotide and the 5′ phosphate of the following one are cleaved by restriction enzymes.

In order to prevent the plasmid vector from ligating with itself and to verify that the inserted gene is oriented correctly, two separate restriction enzyme sites might be used.

A) #1 5′ - CGTGATCTCGATTCGCTAGTAACGTT - 3′

         3′ - GCACTAGAGCTAAGCGATCATTGCAA - 5′

    #2 5′ - TCATGAATTCCTGGAATCAGCAAATGCA - 3′

         3′ - AGTACTTAAGGACCTTAGTCGTTTACGT - 5′

B) Recognition sites:

#1 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

#2 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

C) Cleavage sites:

#1 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

#2 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

The correct and complete question is in the image.

Learn more about Restriction enzymes here:

https://brainly.com/question/13944056

#SPJ4

ELEMENT #3
The radius of my most common ion is larger than my atomic radius.
I have 6 valence electrons.
I have a higher first ionization energy than tellurium.
I am the smallest atom in my group.

What element am I? Write my symbol and standard electron configuration.
*dont have to give me the electron configuration i can find it

Answers

Answer: Oxygen, symbol: O

The first hint tells us its a nonmetal, the second hint tells us the element is in group 6A on the periodic table. This is a giveaway because the smallest atom in group 6A is oxygen.


Someone help me with this please

A scientist sets up an experiment as follows: she puts bromine gas in a flask that is attached to an airless chamber. Describe what the scientist will observe when she opens the tap connecting the chamber to the flask. Explain your answer.

Answers

Answer:

The bromine gas particles would diffuse from a high to low concentration and so move upwards.

Explanation:

Maybe this is your answer ;{

How many joules of heat are needed to change 50.0 grams of ice at -15.0 C to steam at 120.0 C

Answers

The answer is

153.7kJ.

The total energy needed for the water molecules to transition from ice to water and subsequently from water to vapor is what you are asked to calculate.

In order to do this, you'll need to know:

Heat of fusion of water:  ΔHf = 334J/g;

Heat of fusion vaporization of water: ΔHv = 2257J/g;

Specific heat of ice: c = 2.09J/g∘C;

Specific heat of water: c = 4.18J/g∘C;

Specific heat of steam: c = 2.09J/g∘C;

So, the following steps describe the overall process:

1. Calculate the amount of heat needed to raise the ice's temperature from − 15.0∘C to 0∘C:

q1 = m ⋅ Cice ⋅ ΔT = 50.0g ⋅ 2.09J/g⋅∘C ⋅ (0∘C−(−15∘C)) = 1567.5J

2. Calculate the amount of heat needed to convert 0∘C ice to 0∘C water:

q2 = m⋅ ΔHf = 50.0g ⋅ 334J/g = 16700J

3. Calculate how much heat is needed to evaporate water at 0∘C to water at 100∘C:

q3 = m ⋅ Cwater ⋅ ΔT = 50.0g ⋅ 4.18J/g⋅∘C ⋅ (100∘C−0∘C) = 20900J

4. Calculate the amount of heat needed to convert 100∘C water to 100∘C vapor:

q4 = m ⋅ ΔHv = 50.0g ⋅ 2257J/g = 112850J

5. Identify the heat needed to transition from 100∘C vapor to 120∘C vapor:

q5 = m ⋅ Cvapor ⋅ ΔT = 50.0g ⋅ 2.09J/g⋅∘C ⋅ (120∘C−100∘C) = 2090J

Therefore, the total heat required is

qTOTAL = q1 + q2 + q3 + q4 + q5 = 152696.5J = 153.7kJ

Lets learn more about similar numericals

https://brainly.com/question/9764207

a hydrogen atom emits a photon. you are given the wavelength of the photon. what sign will the energy of the photon be calculated as?

Answers

The energy of the photon to will be calculated by using E=hv.

Photons are fundamental subatomic particles that carry electromagnetic force — or, to put it another way, they are light particles. The energy of a photon is calculated by determining the wavelength of the photon. To do this, we need to know the frequency of the light and its speed in a vacuum.

A hydrogen atom emits a photon with a frequency of about 6.6x1014 Hz and a speed in a vacuum of 3.0x108 m/s.

The value for E = hν is:

E = hν

= Planck's Constant × Frequency × Wavelength

= hc/(2π×frequency × wavelength)

The unit of energy is given by Joules(J).

To learn more about photon visit: https://brainly.com/question/20912241

#SPJ4

you have two test tubes. one test tube contains fe 3(aq) solution and the other test tube contains ni 2(aq). predict what will happen when naoh(aq) is added to both test tubes. if a reaction occurs, what is the new chemical formula?

Answers

The new chemical formula is [tex] Fe(OH)_{3}[/tex] or ferric hydroxide.

Ion [tex] {Fe}^{3 + } [/tex] will react with NaOH while [tex] {Ni}^{2 + } [/tex] will not. The chemical reaction is as follows -

Chemical reaction stating reaction between [tex] {Fe}^{3 + } [/tex] and NaOH.

[tex] {Fe}^{3 + } [/tex] + NaOH → [tex] Fe(OH)_{3}[/tex] + Na

In the reaction, [tex] {Fe}^{3 + } [/tex] represents ferric ions, NaOH is the chemical formula of sodium hydroxide, [tex] Fe(OH)_{3}[/tex] is the chemical formula of ferric hydroxide and Na represents sodium. The ferric hydroxide precipitates as reddish brown. It does not dissolve in excess is sodium hydroxide.

Chemical reaction stating reaction between [tex] {Ni}^{2 + } [/tex] and NaOH

Nickel does not react with sodium hydroxide due to its basic nature. The reason can be owed to electron donating characteristic of both the metal and base.

Learn more about metal and sodium hydroxide reaction -

https://brainly.com/question/25597694

#SPJ4

how to identify oxides that don't dissolve in water?

Answers

Answer: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

Explanation: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

whats the phycical property of water

Answers

Answer:

The answer is color, temperature, turbidity, taste, and odor.

if the pressure is decreasing at a rate of 50 kg/m2, the temperature is increasing at a rate of 7.2 k/s, and the amount of gas (i.e., the number of moles) remains the same, what is the rate of change of the volume?

Answers

The rate of change of the volume is 0.144 m³/s.

The average temperature of the air is indicated via a properly exposed thermometer at some point in a given term, usually an afternoon, a month, or a yr. For climatological tables, the mean temperature is generally calculated for each month and for the 12 months. Temperature is an amount that determines the course of the float of warmth on preserving two bodies at one-of-a-kind temperatures in contact. Its SI unit is kelvin (k).

The heat of an object is the total power of all the molecular movement interior that object. Temperature is the measure of the thermal power or average warmness of the molecules in a substance. SI Unit. Joule.

rate of change of pressure = 50 kg/m²

temperature = 7.2 K/s

Using ideal gas equation PV = nRT

since nR is constant

V = T/P

  = 7.2/50

  = 0.144 m³

Learn more about temperature here:-https://brainly.com/question/24746268

#SPJ4

A river flows at a rate of 57.3m/sec, what is the rate when it is converted to km/day? Please answer fast!!!

Answers

4950.72 hope this helps

1. Consider the generic reaction:A + 2BC AH = -55 kJDetermine the amount of heat emitted when each amountof reactant completely reacts (assume that there is morethan enough of the other reactant).(a) 1 mol A(b) 2 mol A(c) 1 mol B(d) 2 mol B

Answers

Answer:

(a) 55 kJ of heat are released when 1 mol of reactant A is used;

(b) 110 kJ of heat are released when 2 moles of reactant A are used;

(c) 27.5 kJ of heat are released when 1 mol of reactant B is used;

(d) 55 kJ of heat are released when 2 moles of reactant B are used.

Explanation:

The question requires us to determine the amount of heat released when the given amounts of reactants are used, considering the following balanced chemical equation:

[tex]A+2B\rightarrow C\text{ }\Delta H=-55kJ[/tex]

When the enthalpy change for a reaction (or heat of reaction, ΔH) is given in units of energy, such as kilojoules (kJ), and not units of energy per mol (such as kJ/mol), we can consider that ΔH corresponds to the heat absorbed or released for the molar quantities of reactants as given in the balanced chemical equation. In the case given by the question, for example, we can say that 55 kJ of energy are released when 1 mol of A reacts with 2 moles of B.

Therefore, we can use the molar quantitites from the balanced chemical equation as a reference to determine the amount of heat released when different amounts of reactants are used.

Considering the information above, we can calculate:

(a) heat released when 1 mol of A reacts:

Note that 1 mol of A corresponds to the amount of reactant A given by the balanced chemical equation. Therefore, 55kJ of energy are released when 1 mol of A is used.

(b) heat released when 2 moles of A reacts:

Note that 2 moles of A corresponds to the double of the amount of reactant A given by the balanced chemical equation. Thus, we must multply ΔH by 2: 55 kJ x 2 = 110 kJ of energy are released when 2 moles of A are used.

(c) heat released when 1 mol of B reacts:

Note that 1 mol of B corresponds to half of the amount of reactant B given by the balanced chemical equation. Thus, we must divide ΔH by 2: 55 kJ / 2 = 27.5 kJ of energy are released when 1 mol of B is used.

(d) heat released when 2 moles of B reacts:

Note that 2 moles of B corresponds to the amount of reactant B as given by the balanced chemical equation. Therefore, 55 kJ of energy are released when 2 moles of B are used.

When calcium reacts with chlorine to form an ionic compound, each metal atom loses electron(s) and each nonmetal atom gains electron(s). there must be calcium atom(s) for every chlorine atom(s) in the reaction.

Answers

When calcium reacts with chlorine, each calcium atom loses 2 electrons, and each chlorine atom gains 2 electrons. There must be one 1 calcium atom for every 2 chlorine atoms in the reaction.

When atoms react, they either lose or gain electron. Atoms do this in order to attain the stable noble gas configuration. Metals are more likely to lose electrons, and non-metals are more likely to gain electrons. Calcium has an atomic number of 20, and its electronic configuration is:

[Ca] = 1s²2s²2p⁶3s²3p⁶4s²

The easiest way for calcium to obtain a stable noble gas configuration is to lose 2 of its electrons, so that it has 18 electrons left. When this happens, calcium becomes a positively charged cation:

Ca ⇒ Ca²⁺ + 2e⁻

Chlorine has 17 electrons with the electronic configuration:

[Cl] = 1s²2s²2p⁶3s²3p⁵

This shows that chlorine only needs one electron to have the stable noble gas configuration. When this happens, chlorine becomes a negatively charged anion:

Cl + 1e⁻ ⇒ Cl⁻

Thus, for calcium to completely react with chlorine, there must be two atoms of chlorine for each carbon atom. This is because calcium loses two electrons, and each chlorine atom only accepts one. Hence:

   Ca²⁺ + 2CL⁻ ⇒ CaCl₂

Learn more about atoms here:

https://brainly.com/question/15170320

#SPJ4

i am pouring concentrated sulfuric acid from a 1-gallon container. i need to use the following ppe for protection against potential splash of a corrosive liquid.

Answers

Personal protective equipments to be worn while handling corrosive liquids are safety goggles, hand gloves  and closed toed shoes.

What are personal protective equipments ?

Personal protective equipment is a protective clothing which is worn to protect the wearer's body  from hazard or injury.The hazards which can be addressed  by the use of personal protective equipment are physical,chemical and bio hazards.

It imposes a barrier between the user and the working environment.The main purpose of personal protective equipment is to reduce exposure of employees to the hazards.

It has a limitation that it does not eliminate the hazard and may lead to harm to the employee if the equipment is damaged.

Learn more about personal protective equipment,here:

https://brainly.com/question/28900790

#SPJ1

Other Questions
They were important because they wrote about many things that Britain and other colonizers were doing wrong and how they were harming the land and the people of Africa. They were important political activists in this aspect and inspired numerous people to join the pan-African movement and support independence from the colonizers How does granger establish montags importance to the groups mission, even though montag lacks academic training?. What was John Dalton's contribution to the development of the atomic theory? What is the slope of a line perpendicular to the line whose equation is x - y = 6. Fully reduce your answer. Answer: Submit Answer Help me with this ,8th grade math look at attachment100 points The rockets velocity just before it hits the ground is the same magnitude as the initial velocity. Use the appropriate kinematics equation to show that this is true. WILL MARK BRAINLIEST LOTS OF POINTS! don was temporarily dismissed from his company because sales are slow. when the situation improves at the company, he will likely be brought back as an employee. this is an example of being . $4500 is deposited for 4.5 years in an account that pays 4.5% interest compounded monthly. What is the value of the account when the customer takes the money at the end of the 4.5 years? evaluate T^T -[tex]x^{2}[/tex]+3x for x=-3 What is the slope of a line perpendicular to the line whose equation is 6x+8y=128. Fully simplify your answer. Can someone please help me graph this? Its due in 5 minutes help please i have a 17 as a grade :) logan company and clayton company assign manufacturing overhead to work in process inventory using direct labor cost. the following information is available for the companies for the year: logan company clayton company actual direct labor cost $ 200,000 $ 112,500 estimated direct labor cost 187,500 125,000 actual manufacturing overhead cost 72,500 95,000 estimated manufacturing overhead cost 75,000 100,000 required compute the predetermined overhead rate for each company. determine the amount of overhead cost that would be applied to work in process inventory for each company. compute the amount of overapplied or underapplied manufacturing overhead cost for each company. What was the purpose of Andrew Jackson's message to Congress "On IndianRemoval? Rachel and Nicole are training to run a half-marathon. Rachel begins by running 30 minutes on the first day of training. Each day she increases the time she runs by 3 minutes. Nicoles training follows the function f(x)=5x+30, where x is the number of days since the training began, and f(x) is the time in minutes she runs each day. What is the rate of change in minutes per day for the training program that has the slowest rate of change?............ minutes per day individuals who do not consume enough dietary fiber from natural food sources can take dietary supplements (e.g., psyllium), to obtain the health benefits of increased fiber intake. true false question. true false A piece of rope 60 meters long is cut into twopieces so that the longer piece is twice thelength of the shorter. How long are the twopieces? Step 1: Add 7 to x .Step 2: Multiply by 6 On 2 fer Tuesday 2 bagels with cream cheese cost $2.50. Jimmy wants to buy 2 dozen bagels (24 bagels). How much will this cost? Select TWO criticisms of humanism.The humanists believe all behavior originates in the unconscious.Humanism fails to take emotions and childhood experiences into account.Evil acts challenge the humanist view that human nature is essentially good.Humanists are unable to measure self-actualization.