please help me with this question:)

Please Help Me With This Question:)

Answers

Answer 1
true now give me brainliest thx
Answer 2

Answer:

The answer is true


Related Questions

A marble has a mass of 11.8 g. It has a volume of 3.7 cm3. What is the density of the marbl

Answers

Answer:

11.8/3.7= 3.1891891892

Explanation:

Divide 11.8 by 3.7 and instead of putting all of the numbers, just put 3.18

Explain how exercise and an active lifestyle can improve bone health
and bone density.

Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.

Answers

Explanation:

explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of

Which process plays an important role in the cycling of both carbon and nitrogen? photosynthesis transpiration decomposition respiration

Answers

Answer: C

Explanation:

Decomposition plays a major process to cycle the carbon and nitrogen due to dead matter, hence option c is correct.

What is the cycling of carbon and nitrogen?

The biogeochemical cycles of carbon and nitrogen are all in plants and animals when dies bacteria decompose it and release nitrogen and carbon into the soil.

They depict how the elements travel through the Earth's life and nonliving constituents. The elements of life—carbon, and nitrogen pass through living things and nonliving things alike without ever being consumed.

Nitrification is the process by which bacteria convert ammonium into nitrates. Then, the plants may take up nitrates. It is through assimilation that plants obtain nitrogen, roots take up nitrates from the soil.

Therefore decomposition is the main process for cycling of both carbon and nitrogen, hence option c is correct.

Learn more about decomposition, here:

https://brainly.com/question/1620230

#SPJ5

Which of the following is a frameshift mutation from the original DNA of CGCATTGGA?


a. CGCATTGGA

b. CGGCATTGGA

c. CGCATTGGT

d. GGCATTGGA

Answers

Answer: b.

Explanation:

Cgc,att,gga - original

cg(g)c,att,gga. Frame shift

cgc,att,gg(t) snp

(g)gc,att,gga snp

What is a vein in rock?

Answers

Answer:

Vein, in geology, ore body that is disseminated within definite boundaries in unwanted rock or minerals (gangue). The term, as used by geologists, is nearly synonymous with the term lode, as used by miners. There are two distinct types: fissure veins and ladder veins.

Explanation:

Material deposits known as geological veins are created when an existing rock fracture is filled with a new mineral.

How rock veins are formed?

   

They are fascinating to planetary scientists because they frequently reveal information about historical water flow. For instance, a lot of rocks have natural pores.

A vein in geology is a distinctive sheet-like body of mineral crystals embedded into a rock. When precipitation occurs, mineral components that are transported by an aqueous solution within the rock mass are deposited as veins.  

Therefore, it is thought that aqueous solutions carrying different elements migrate through rock fissures and deposit their load onto the fissure walls when vein deposits occur, rising water that is hot.

Learn more about rocks, here:

https://brainly.com/question/993114

#SPJ2

Which of these will weigh the same after it has undergone a change?

A.) Paper being burned.

B.) Sugar water being evaporated.

C.) Two chemicals reacted to form gas.

D.) Ammonia added to steel wool to create heat.

Answers

i think the answer is D
A is the more formatted answer

SOMEONE PLZ HELP ME !!!!!!!!!!!!!!!!!!

Answers

Answer:

plant :)

Explanation:

Some individuals can develop kidney failure after consuming fava beans. What is the biochemical rationale for this observation?A. A deficiency of glucose-6-phosphatase that resulted in failure to synthesize essential red cell membrane proteins.B. A deficiency of glucose-6-phosphate dehydrogenase that resulted in failure to maintain glutathione in a state that prevents destructive lysis of the red blood cell.C. A deficiency of transketolase that resulted in the failure to provide ribose for the DNA and RNA needed to repair red cells.D. A deficiency of transaldolase that resulted in the failure to maintain glycolysis in the red cells. E. A deficiency of sedoheptulose that resulted in the failure to maintain the integrity of the red cells.

Answers

The correct answer to the question is option B

A deficiency of glucose-6-phosphate dehydrogenase that resulted in failure to maintain glutathione in a state that prevents destructive lysis of the red blood cell.

The deficiency of Glucose 6 phosphate dehydrogenase is a genetic disorder,when certain foods are consumed,the deficiency symptom to the enzyme is triggered and one of such food is Fava beans.

in Fava beans, Vicine is found, and this Vicine is an alkaloid glycoside.

Vicine is an oxidant,and it is toxic by causing disease favisim in individuals.The individual being affected are the ones that have hereditary loss of the Glucose 6 phosphate dehydrogenase enzyme.

But favisim only occurs when Fava beans is ingested fresh, that is without cooking it.

Following this,there is the development of acute intravascular hemolysis within 4-24hours after the ingestion of the Fava beans,there might also be a fall in the hemoglobin content of the blood and this may result in fatal condition.

But in cases that are acute, that is case of hemolysis, blood transfusion is vital and also in the case is kidney failure, dialysis must be done.

The reason why blood transfusion is very necessary is because the blood transfused may not have red blood cells that are deficient of Glucose 6 phosphate dehydrogenase,also the cells can have normal lifespan in the blood circulation of the recipient.

This Glucose 6 phosphate dehydrogenase is vital because it is a metabolic enzyme of Pentose phosphate pathway and it is also important for the metabolism of red blood cells.It also gives red blood cells protection from oxygen species that are harmful and reactive.

Option A is a metabolic disease that is

inherited which results in accumulation of glycogen and fat in liver.

Option C is as a result of deficiency in thiamine and malnutrition.

Option D is as a result of mutation in transaldolase gene.

Option E is as a result of genetic mutation.

When our brain fills in missing pieces, this is called:

Answers

Answer:

I think it's called 'filling in'

Explanation

Hope this helps :)

Answer:

I think its called resoration

1. Muscles function in ____________ of the head, neck, and limbs, as well as propulsion of the contents through the digestive tract.2. Muscles function in _____ by preventing unwanted movement, as in maintaining posture. 3. Using _____, or valves, muscles control the passage of contents from one body cavity or lumen to another. 4. Since muscle contraction requires energy to do work, movement muscles help maintain our body _____. 5. By absorbing a large share of one's _____, muscles play an important role in blood sugar control.

Answers

Answer:

1. Muscles function in movement of the head, neck, and limbs, as well as propulsion of the contents through the digestive tract.

2. Muscles function in stability by preventing unwanted movement, as in maintaining posture.

3. Using sphincters, or valves, muscles control the passage of contents from one body cavity or lumen to another.

4. Since muscle contraction requires energy to do work, movement muscles help maintain our body heat.

5. By absorbing a large share of one's glucose, muscles play an important role in blood sugar control.

Explanation:

Muscles have different functions in the body. They allow our head, neck and limbs to move, and also have an important role in the propulsion of contents through the digestive track.

Muscles are soft tissues that also have a role in stability by maintaining posture and help the passage of contents from different cavities by using sphincters.

Their main source of energy is glucose in the body. By using this energy, muscles help to maintain our bodies temperature and blood sugar control.

A colleague has used computer modeling to design an improved enzyme. To produce this enzyme, the next step is to:___________.
A) look for a bacterium that makes the improved enzyme.
B) mutate bacteria until one makes the improved enzyme.
C) determine the nucleotide sequence for the improved enzyme.
D) synthesize the gene for the improved enzyme.
E) use siRNA to produce the enzyme.

Answers

Answer:

C) determine the nucleotide sequence for the improved enzyme.

Explanation:

Computational enzyme design (CED) can be defined as a bioinformatic in silico approach used to model, construct, and enhance enzyme catalysis. CED uses complex optimization algorithms that enable to direct evolution by using computational systems. As a further step, after the modelization of optimal enzymatic activity, bioinformaticians require to determine the nucleotide sequences which will be subsequently used to synthesize the corresponding enzymes.

Compare the normal allele for hemoglobin with the sickle cell allele. How does this difference affect the person’s red blood cells?

Answers

Answer:

Sickle cell anemia is an inherited condition in which there aren't enough healthy red blood cells to carry oxygen through an individual's body. The red blood cells of a healthy individual are flexible and round, and they move through blood vessels with no problem, transporting oxygen successfully. However, a person with sickle cell anemia has rigid, sticky red blood shaped like sickles or crescent moons. These cells often get stuck in small blood vessels, which can slow or block blood flow and oxygen delivery to different parts of the body.

The sickle cell anemia trait is found on a recessive allele of the hemoglobin gene, while the regular red blood cell trait is found on the dominant allele. This means that a person must have two copies of the recessive allele (one from their mother and the other from their father) to be born with this condition. People who have one dominant and one recessive allele or both dominant alleles will have healthy red blood cells.

Which of these zones of the ocean is deepest?
A. Abyssopelagic
B. Epipelagic
C.Hadalpelagic
D. Bathypelagic

Answers

hadalpelagic is the zone of the ocean is deepest.

What makes you throw up? Explain why and how you know.

Answers

school pizza makes me throw up it just tastes so fake yk

Answer:

Explanation:

causes of vomiting in adults include: Viruses (gastroenteritis, aka “stomach flu”) and bacteria (food poisoning). Overindulgence (drinking too much alcohol or smoking too much marijuana). Medical conditions (pregnancy, motion sickness, migraines, vertigo).

How does heat affect enzymes?

Answers

Raising temperature generally speeds up a reaction, and lowering temperature slows down a reaction. However, extreme high temperatures can cause an enzyme to lose its shape (denature) and stop working. pH: Each enzyme has an optimum pH range. ... Extreme pH values can cause enzymes to denature.

Answer:

Temperature

Explanation:

Raising temperature generally speeds up a reaction, and lowering temperature slows down a reaction. However, extreme high temperatures can cause an enzyme to lose its shape (denature) and stop working. pH: Each enzyme has an optimum pH range. Extreme pH values can cause enzymes to denature.

What is the contour interval of this map?

Answers

Answer:bird creek

Explanation:

what are the density of deep ocean currents are effected by​

Answers

Answer: Deep ocean currents are density-driven and differ from surface currents in scale, speed, and energy

Explanation:

What are internal structures?

Answers

Answer:

Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.

Explanation:

Digestion of an unlabeled carbohydrate results in increased amounts of the monosaccharides glucose and galactose. Which is most likely to be the original, unlabeled carbohydrate?

Answers

Answer:

lactose  

Explanation:

Lactose is a disaccharide sugar made up of glucose and galactose monosaccharide subunits. In lactose, galactose and glucose molecules form a covalent glycosidic bond denoted as an (β-1→4) glycosidic bond. Lactase is an enzyme that hydrolyzes lactose into glucose and galactose, which can be then absorbed into the bloodstream by the cells lining the small intestine. In an alkaline solution, lactose may also isomerize to generate a mixture of lactulose (20-30%) and lactose (70-80%).

Two genes interact to produce various phenotypic ratios among F2 progeny of a dihybrid cross. Design a different pathway explaining each of the F2 ratios below, using hypothetical genes R and T and assuming that the dominant allele at each locus catalyzes a different reaction or performs an action leading to pigment production. The recessive allele at each locus is null (loss-of-function). Begin each pathway with a colorless precursor that produces a white or albino phenotype if it is unmodified. The ratios are for F2 progeny produced by crossing wild-type F1 organisms with the genotype RrTt. Which statement is correct? 12/16 white: 3/16 green: 1/16 yellowA) At least one copy of both dominant alleles results in white; at least one copy of one of the dominant alleles also results in white, but at least one copy of the other dominant allele produces green; and the absence of either dominant allele produces yellow.B) If both dominant alleles are present, the result is green. At least one copy of one specific dominant allele is required for yellow. If that dominant allele is not present, the result is white, regardless of whether the other dominant allele is present.C) At least one copy of each dominant allele results in white, at least one copy of either dominant allele produces green, and the absence of either dominant allele produces yellow.

Answers

Answer:

wow ang haba naman yan broo hirap basahin

which type of transport requires energy to move a cell

Answers

Answer:

Active transport.

Hope this helps!

what are the different components at Ecosystem?​

Answers

Answer:

abiotic constituents, minerals, climate, soil, water, sunlight, and all other nonliving elements, and its biotic constituents,

Explanation:

How does ground water relate to lakes or rivers?

All lakes and rivers are replenished by groundwater.
When ground water reaches the surface it can form lakes or rivers.
Groundwater can affect the size of lakes and rivers.
Lakes and rivers produce groundwater.

Answers

B is the answer you are looking for

Answer:

When ground water reaches the surface it can form lakes or rivers.

Explanation:

Groundwater in valleys is often pushed under pressure by rainwater that falls on the nearby highlands. If the water table reaches the surface, a lake, a river, or a spring is formed. A spring in desert country is surrounded by plants that take advantage of the water supply, forming an oasis. Water now coming to the surface at oases in the Sahara Desert came from rain that fell on hills near the desert during the Middle Ages--eight hundred to one thousand years ago.

Hope this helps   :)))))

1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?

Answers

Answer:

1.

contrast between mitosis and meiosis

Mitosis

- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)

- exact number of chromosome in offspring

- no recombination or crossing over

- no pairing found

- major phase: prophase, metaphase, anaphase, telophase

Meiosis

- takes place in sex cells to form gamete formation during sexual reproduction

- half of the chromosome number found in gametes of the parents thus, known as reduction division

- due to crossing over takes place recombination  found.

The pairing of chromosomes takes place

- major steps:

Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and

Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase

2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.

The major events are as follows:

G1- RNA and protein synthesis takes place and cell grows in size

S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.

G2-  RNA and Protein synthesis continues.

what is the difference between the spermatozoon and spermatogonium?​

Answers

Answer:

Sperms are the male gametes produced in the seminiferous tubules of the testes. The main difference between spermatogenesis and spermiogenesis is that spermatogenesis is the formation of sperm cells whereas spermiogenesis is the maturation of the spermatids into sperm cells.

Pls give Brainliest!!

The cell cycle is highly regulated and involves many steps to ensure that a cell is ready to divide. For this reason, cells cycle between interphase and mitosis. Suppose a cell culture of 1,000 cells is grown, in which the cells cycle every 24 hours. For a single cell, it takes about two hours from the formation of the dissolution of the nuclear envelope to the separation of two daughter cells.

Which of the following best describes the approximate number of cells in the culture that are in interphase, as well as the consequence of the severe disruption of interphase in mitotic division of cells within a tissue?

A) There are approximately 917 cells in interphase. Disruption of interphase will have no effect on mitosis because they are two completely independent processes.
B) There are approximately 83 cells in interphase. Disruption of interphase will lead to a faster and more efficient mitotic cycle, which will result in increased cell division and tissue growth.
C) There are approximately 917 cells in interphase. Disruption of interphase will trigger the cell to switch to a mitotic phase and repeatedly divide, which will result in the massive proliferation of the cells and heightened tissue growth.
D) There are approximately 83 cells in interphase. Disruption of interphase will result in the cell being unable to synthesize proteins and organelles required to divide, which will result in the cell not passing key checkpoints and ceasing to divide.

Answers

Answer:

The two major phases of the cell cycle include mitosis (cell division), and interphase, when the cell grows and performs all of its normal functions. Interphase is further subdivided into G1, S, and G2 phases. After the synthesis phase, the cell proceeds through the G2 phase.

Explanation:

Answer:

I believe it is the first one not 100 percent tho

Explanation:

if today's first high tide is at 7:00 AM, what time will today's next high tide be? Please do not troll. . . . I have already asked this question like 7 times already and got no answer, except foolishness. Please. :(

Answers

7:25 pm. High tides are 12 hours and 25 mins apart. So 12 hours from 7:00 am is 7:00 pm, add 25 mins and you have 7:25 pm. Hope this helps! ;)

Which of the following is a biotic factor?

A) Sunflower
B) Carbon dioxide
С) Soil
D) Sunlight

Answers

Answer:

A) Sunflower

Explanation:

Answer:

a) sunflower

Explanation:

because it is a living thing.

For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen

cycle. Which statement explains how fertilizers impact an ecosystem?

O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.

O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.

O Fertilizers kill off important nitrogen fixing bacteria.

Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.

Answers

Answer:

It's C

Explanation:

Hope this helped :)))

The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.

What is Nitrogen cycle?

Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.

Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.

Therefore, the correct option is C.

Learn more about Nitrogen cycle here:

https://brainly.com/question/1615727

#SPJ2

Why is meiosis important for organisms?
It allows for genetic variation among organisms.
It determines which genes are dominant and which are recessive.
It produces genetically identical cells.
It provides a means of asexual reproduction?

Answers

Answer:

It allows for genetic variation among organisms.

Explanation:

Answer:

It allows for genetic variation among organisms.

Explanation:

meiosis is the process of chromosomal reduction which allows the production of haploid germ cells necessary for sexual reproduction. Meiosis is furthermore important for its role in enabling genetic diversity and facilitating the repair of genetic defects through recombination

Other Questions
Which graph below correctly shows the two lines on the same axes ? Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8B. 16 C. 32 D. 64 Which thesis is stronger? Explain your answer using complete sentences.A) Globalization has created many new jobs in India. B) Globalization has had a positive effect on India because it offers new solutions to poverty. What is your best memory? In the story behind Barz vets with PTSD basin new Warzone with little support how did David Carlson time at war change him A scientist walking through a forest recorded as integers the heights of 5 trees standing in a row. She observed that each tree was either twice as tall or half as tall as the one to its right. Unfortunately some of her data was lost when rain fell on her notebook. Her notes are shown below, with blanks indicating the missing numbers. Based on her observations, the scientist was able to reconstruct the lost data. What was the average height of the trees, in meters? why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were