Answer:
so hope it helps i think.
Explanation:
Chronic coughing.
Recurring chest colds.
Wheezing or shortness of breath.
Frequent sinus infections.
Very salty-tasting skin.
Answer: person above is correct
Explanation:
Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.
excluded from work
allowed to continue her duties as long as she does not start to feel worse
reported to the health department
restricted from working with food
The similarity of the structures shown in the picture suggests that the organisms_______
1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly
sources of potassium for plants
Answer:
mined rock powders and wood ash.
Explanation:
Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane
Answer:
moving across both the plasma membrane and the outer membrane
Explanation:
Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.
2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration
Answer:
A . the formation of male and female sex cell is known as gametogenesis
Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.
The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.
What do you mean by predators ?
Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.
Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.
The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.
Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.
Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.
Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).
Learn more about predators click here:
https://brainly.com/question/29779690
#SPJ1
what is photo synthesis?
Answer:
The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).
Answer:
photo synthesis is the green plants which making other organisms to convert engry into chemical
¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada
Answer:
D.Grupos taxonomicos
Explanation:
Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.
Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.
El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.
Which of the following is a subsystem of an organism?
Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts
Answer:
Name one waste substance the coronary veins will remove.
…………………………………………………………………………………………………..……………………
helpp mee pleaseeee need help
Answer: it will increase the frequency of the action potential hope this helps
Explanation:
Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms
B. bacteria
C. aliens
D. related
Answer:
Hi, there the answer is D. related
Explanation:
Homologous structures are similar structures in related organisms.
Hope This Helps :)
Answer:
it is d i think
Explanation:
what are the four primary uses or benefits of the nguni breed amongst South African communities?
Answer:
Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.
Explanation:
I have no clue and the internet doenst help
Answer:
Soda
Explanation:
These are some weird questions...
I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.
How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.
Explanation:
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet
Explanation:
Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog
Answer:
Beatle
Explanation:
Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
What is Food Web?A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.
A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.
In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.
Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
Learn more about Food Web, here:
https://brainly.com/question/18816028
#SPJ2
Which statement is true about gene expression? Give brainlist is answer right
Cells become specialized because different cells contain different sets of genes
Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used
A cell becomes specialized by controlling the which proteins are produced from the cell's DNA
Answer:
I guess All of them
Explanation:
Gene expression has all of these statements as given above in text.
Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.
B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.
C. Scientists breed cows that give greater amounts of milk than their ancestors.
D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.
E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.
Answer:
The Answer is C
Explanation:
When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.
Answer:
C. Scientists breed cows that give greater amounts of milk than their ancestors.
Explanation:
The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.
A 9.0 is how many times more powerful than a
4.0 on the Richter scale?
Answer:
It increases 31.7 times between whole number
values.
Explanation:
"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."
1. Osmosis and diffusion are same phenomena.
Answer:
they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'
Explanation:
Answer:
Explanation:
Not the same
Pls help this is due today
Answer:
scientific method can help resolve problems logically
Answer:
b. scientific
Explanation:
the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.
hope this helps! lemme know if you need more
What is the main function of the central nervous system ? E2020
Answer:
The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.
Explanation:
Answer:
Main function-the interpreter of the environment and control over body movement.
The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..
5.
Name three factors that may affect the carrying capacity of the population. (3 points)
DNA acts as a _____________ for living things
A. map
B. blueprint
Answer:
A. map
Explanation:
DNA acts as a map for living things.
In your own words, can you explain where a hot
spot can be found AND what does it looks like?
Answer:
well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of
What is anatomy?
Simple answer please!
I'll give brainlist
Answer:
Anatomy is the study of the bodies of people and other animals
hope this helps
have a good day :)
Explanation:
Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.
Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?
Answer:
Do a literature search to find natural history information on closely related species.
Explanation:
In the context, few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.
They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.
which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes