Read the sentence and answer the question,
Only one word came to Sanjay's mind as he watched the sun set over
the ocean-awe.
What is the function of the dash in this sentence?
Select one:
To emphasize Sanjay's feelings
To summarize Sanjay's actions
to illustrate the beauty of the sunset
to change the tone of the sentence

Answers

Answer 1

Answer:

i think its the to illustrate the beauty of the sunset , im not sure pls dont be mad

Explanation:

Answer 2

Only one word came to Sanjay's mind as he watched the sun set over

the ocean-awe the function of the dash in this sentence as to illustrate the beauty of the sunset.

What is the use of dash?

It's longer than a hyphen and is usually used to suggest a variety or a pause. Dashes are used to split businesses of phrases, now no longer to split components of phrases like a hyphen does. (examine extra approximately the distinction among a sprint and a hyphen here). There are 3 types of dashes: em, en, and the double hyphen.

Only one word came to Sanjay's mind as he watched the sun set over the ocean-awe.To illustrate the beauty of the sunset is the function of the dash in this sentence.

Read more about the actions:

https://brainly.com/question/1138265

#SPJ2


Related Questions

Help plz:))) I’ll mark u brainliest
How is ambition not always a negative trait? 5 sentences pls [^_^]

Answers

Answer:

Although being ambitious is a positive personal character trait, being too ambitious can result in negative character traits. Some people may have such a great desire to succeed and are so ambitious to reach the top that they may be ruthless, dishonest or harmful to others.

Explanation:

looked up

Antwan tends to get bored walking in the park, watching the birds, getting mud on his shoes, and sometimes getting lost.

The sentence above is a
A.
compound-complex sentence.
B.
simple sentence.
C.
compound sentence.
D.
complex sentence.

Answers

Answer:

I would do C but im not sure

MAKE MEMORYS THAT WILL LAST FOREVER

Answers

Answer:

um okayyyyy???

Explanation:

Okay thank you for the advice I love you

The ___________________ is the one who tells the story. a. author c. tone b. narrator d. voice

Answers

Answer:

narrator tells the story

Explanation:

hope this helps!!

Is there a difference between the title of the speech/paper/essay, and a header When used?

Answers

Yes a header goes in the corner, and says the page number and the last name of the author

Which three lines in this excerpt from Anita Desais "Games at Twilight" clearly show an omniscient narrator?
They faced the afternoon. It was too hot. Too bright. The white wals of the veranda glared stridently in the sun. The bougainvillea hung aboutit.
purple and magenta. in livid balioons. The garden outside was like a tray made of beaten brass, flattened out on the red gravel and the stony
soil in all shades of metal-aluminum, tin, copper, and brass. No life stirred at this arid time of day-the birds stil drooped, like dead fruit. in the
papery tents of the trees: some squirrels lay limp on the wet earth under the garden tap. The outdoor dog lay stretched as if dead on the
veranda mat. his paws and ears and tail all reaching out like dying travelers in search of water. He rolled his eyes at the children-two white
marbles rolling in the purple sockets, begging for sympathyand attempted to lift his tail in a wag but could not. It only twitched and lay still.
Then. perhaps roused by the shrieks of the children, a band of parrots suddenly fell out of the eucalyptus tree, tumbled franticaly in the still.
sizzling air, then sorted themselves out into battle formation and streaked away across the white sky.
The children, too, felt released. They too began tumbling, shoving. pushing against each other, frantic to start. Start what? Start their business.
The business of the children's day which is-play.

Answers

The lines that show an omniscient narrator are: “The garden outside was like a tray made of beaten brass, flattened out on the red gravel and the stony soil in all shades of metal—aluminum, tin, copper, and brass.”

Who is an Omniscient Narrator?

This refers to a person that makes narration with the all-knowing and all-seeing knowledge as he knows the thoughts, feelings, and actions of characters in a story.

From the complete text, there is the narration that shows the use of an omniscient narrator which shows the description of the garden outside and surrounding environment.

Read more about omniscient narration here:

https://brainly.com/question/928756

#SPJ1

I miss her every minute of the day, and no one knows how often I think of her; whenever I do, my eyes fill with tears.

How does this detail develop Anne’s voice? Select all that apply.

It sets a joyful tone.
It lets Anne show how she cries over Moortje.
It uses dialogue to show her personality.
It shows how Anne feels toward her cat.
It lets Anne share a secret feeling that her family does not know about.

Answers

Answer:

it lets Anne show how she cries over Moortje

it shows how Anne feels towards her cat

it let's Anne share a secret feeling that her family dosent know about

Explanation:

EDGE

Answer:

^ The person above me is correct.

Explanation:

guys need help can you make 5 sentences that can be describe chinese cuisine?​

Answers

Answer:

良い日をお過ごしください^^

Explanation:

Answer:

良い日をお過ごしください^^

Explanation:

What makes Holmes face Moriarty

Answers

Answer:

Moriarty the Patriot is a Japanese cartoon simulacrum of Holmes' most infamous rival, an anarchist who wants to topple the social order and eat the rich.

Explanation:

Most people walking along the boardwalk enjoyed the ocean air. The air was a fresh and salty combination.
combined using appostive phases

Answers

Answer:

The people walking along the boardwalk enjoyed the fresh and salty ocean air.

Explanation:

I think this is what you wanted

Zoom in to see better

Answers

Answer:

c. it can be a terminating or repeating decimal

Explanation:

Read the paragraph. In conclusion, the work of Foley artists is only one step in the overall filmmaking process. By adding the appropriate sound effects, Foley artists create a level of realism that helps the audience embrace the premise of the film, whether it is some crazy alien adventure or something based on everyday life. Which phrase should be revised to match the objective tone and formal style of the rest of the paragraph? work of Foley artists is only one step Foley artists create a level of realism it is some crazy alien adventure something based on everyday life

Answers

Answer:

it is some crazy alien adventure

Explanation:

if you want to write a formal styled paragraph, you wouldn't say "it is some crazy alien adventure" because it sounds more informal and lazy. "crazy" is also considered an opinion-related word.

The phrase that should be revised to match the objective tone and formal style of the rest of the paragraph is:

it is some crazy alien adventure.

Let's explore why the above option is the correct answer.

What is an objective tone?An objective tone doesn't actually show any form of feelings for or against a particular topic. It usually creates a formal tone. Whereas subjective tone is bias, emotional and often informal, objective isn't like that.

The use of "it is some crazy alien adventure" actually depicts an informal tone because the use of "crazy" isn't ideal in a formal language.

Thus, the above option is the correct option that needs to be revised to match the formal style and objective tone of the rest of the passage.

Learn more about Objective Tone on https://brainly.com/question/17014787

How is listening to the poem "Friendship" being read aloud different from reading it silently?




Reading the poem aloud reveals a rhythm that may not be apparent when the poem is read silently.


There is more emphasis placed on the word "friendship" when the poem is read aloud than when it's read silently.


Reading the poem aloud makes it easier to know where each stanza begins and ends.


Hearing each word enunciated correctly makes the humor of the poem more obvious and apparent.

Answers

Answer:

D

Explanation:

Answer:

Reading the poem aloud reveals a rhythm that may not be apparent when the poem is read silently.Explanation:

Any literature experts here that could help, much thanks.

Answers

It could represent pimp because of other meanings like how some words have Latin hidden meanings. Basically like that.

Which statement from the text BEST supports the influence of the glassblowing methods that Romans had on glassmaking?
A. Then, it is put into a mold or shaped with tools (paragraph 3).
B. Adding a variety of colors to clear glass can produce beautiful works of art (paragraph 2).
C. As a result of this new technique, glass objects of many sizes and shapes could be made quickly (paragraph 4).
D. Despite the restrictions, however, many glassmakers escaped Venice and took their skills across Europe (paragraph 5).

Answers

Answer:

C. As a result of this new technique, glass objects of many sizes and shapes could be made quickly (paragraph 4).

Explanation:

The statement from the text that BEST supports the influence of the glassblowing methods that Romans had on glassmaking is option C.

This is because, unlike the other options, option C shows the effect of the new technique and how more glass's could be made at a faster rate.

4. Which passage from the excerpt most strongly suggests that Phineas is in
danger of having an accident?

Answers

Answer:A

Explanation:because I did the question already and I got it right

Maya Angelou was a mother and grandmother. Maya Angelou was one of the nation's preeminent literary figures.
What is the best way to combine the information in the two sentences?
A.
Maya Angelou, one of the nation's preeminent literary figures, was a mother and a grandmother.
B.
Maya Angelou was a mother and grandmother of one of the nation's preeminent literary figures.
C.
Maya Angelou was one of the nation's preeminent mothers and grandmothers.
D.
Maya Angelou was a mother, grandmother, was one of the nation's preeminent literary figures.

Answers

Answer:

A. Maya Angelou, one of the nation's preeminent literary figures, was a mother and a grandmother.

Explanation:

"Maya Angelou was a mother and grandmother. Maya Angelou was one of the nation's preeminent literary figures."

The best way to combine the information in the two sentences is option A.

This is because, unlike the other options, option A kept the meaning of the combined sentences without distorting or making it ambiguous.

Combining the two sentences show that Maya Angelou was prominent, as well as a mother and grandmother.

Answer:

a

Explanation:

Why are workers losing interpersonal skills?

Answers

Answer:

Explanation:

they are losing there interpersonal skills because they are not properly trained to speak to customers.

I saw her (a few /few) days ago. She was with her boyfriend.
I know that we should use afew but i do not know why can't we use few!!!
What is different? ​

Answers

Answer:

You don't use "few days ago" simply because it's improper english.

Explanation:

Scarlet is directing a cable newscast. She wants to learn more about bias to make sure she produces the best, balanced newscast. Give Scarlet three examples of types of bias she could use to understand how the newscast could shift information in a positive or negative way.

Answers

Answer:

Advertising Bias

This type of bias occurs when the newscaster or the news service presents news in such a way that it favors an entity instead of in an impartial way. For instance, reporting poor financial earnings reports such that people would not lose faith in the relevant company.

Selection bias

This occurs when the news service picks and chooses what kind of news it will present based on an agenda that they would like to push upon people instead of maintaining neutrality. For instance, Fox news giving positive news about the Presidency and CNN doing the opposite.

Mainstream bias

This occurs when the news presented or selected is done such that most people are not offended. It is quite prevalent in society and will involve most news services pushing the same narrative so that they do not fall out of favor with viewers.

what is the meaning of life?

Answers

Answer:the meaning of life.. thats a good question

Explanation:

What motif appears in this passage? gn omens that suggest that the army may be victorious blood that appears because the birds feed off of dead bodies flattery that consumes most characters in the play an omen that predicts misfortune for Cassius's army​

Answers

Answer:

D.)an omen that predicts misfortune for Cassius’s army

The motif is a sign that predicts misfortune for Cassius armed force. It should be noticed that in writing, motifs simply means a word or picture that resembles something else in writing.

What is main idea of the text?

This sort of symbolism is used by Shakespeare when the normal request of things is going to be disturbed. The storm means Caesar's demise is not valued by the gods and will absolutely carry misfortune with it.

Cassius, nonetheless, after seeing the storm, chooses to decipher it as a sign that the gods don't believe Caesar should be delegated a ruler. His decision of misinterpretation leads to his own ruin.

Incidentally enough, it was a misinterpretation that made him commit. Someone wrongly reports that Cassius' military has been crushed.

For more information about motif, refer the following link:

https://brainly.com/question/13989039

the mayor wants to rename our city and i need to persuade him that my name is good

Answers

Give him facts and reason

why does rachel say only it's too late after describing her birthday party

Answers

Answer:

what book is this supposed to be on?

Explanation:

How does the organizational structure of the passage help develop the main idea? Handwritten cards sent through the mail are the most meaningful way to communicate with someone you care about. First of all, sending a handwritten card takes planning. You have to purchase a card, look up the recipient's address, and find a stamp to mail it. A handwritten card is also a meaningful keepsake because the recipient can display it or keep it in a special place to look at again and again. Finally, the recipient can enjoy a handwritten card without feeling the need to respond immediately. A The chronological structure traces the decline of handwritten​

Answers

Answer:

its c or d

Explanation:

i don't know wich one ill add a coment later ima guess


What is one way in which the structures of both poems are alike?
A. Both poems include questions.
B. Both poems repeat key lines.
C. Both poems have stanzas of uniform length.
D. Both poems have more than one stanza.
E. Both poems have predictable rhythm.

Answers

Answer:

what are the poems?

Explanation:

I need to see the poems in order to answer the question

Does anybody like my story im still working on it.

Answers

Answer:

But unfortunately, I don't like to read the text, those words look dazzling.

Where is the real Greek Mythology day camp in this audio story?

Answers

Answer:

e.................

Explanation:

Someone help me i need the answer

Answers

Answer:

First person

Explanation:

First person is I, me, my, we

The story "The Veldt" by Ray Bradbury takes place in a futuristic setting where technology does just about everything for families. The children in
this story, Wendy and Peter, have a room called the nursery which is made up of five wall-sized TV screens which cover each wall and the ceiling
Every part of the room is there to make your experience inside it feel as realistic as possible. Their parents, George and Lydia, are growing more
and more concerned that their children seem to be fixated with visiting an African veldt in the nursery. Every time they go in, they see them in
the hot, dry air Watching lions feast on their prey in the background. Eventually, their parents become so concerned that they lock up the
nursery. Peter in response makes vague threats toward his father. After this, George invites over his friend, David, who is a psychologist to get
his perspective on the situation. George and David find that the children have broken into the nursery and are sitting in the African veldt again.
After analyzing the scene left in the nursery, David recommends that George shut the house off entirely. The children throw a hysterical tantrum
at having the house shut off and scream that they wish their parents were dead. Eventually their hysterics are enough to convince their parents
to let them in the nursery one last time before they leave on a vacation and shut the house off for good. When David returns to take the family
to their vacation, he finds only the children in the nursery.
Which evidence best supports the theme that relying too heavily on technology can be a bad thing?
O "I feel like I don't belong here. This house is wife and mother now, and nursemaid. Can I compete with an African velde? Can I give a bath
and scrub the children as efficiently or quickly as the automatic scrub bath can? I cannot" (Bradbury 4).
O "They were awfully young, Wendy and Peter, for death thoughts" (Bradbury 5).
O "And although their bed tried very hard, the two adults couldn't be rocked to sleep for another hour" (Bradbury 8).
O "This house which clothed and fed and rocked them to sleep and played and sang as was good to them" (Bradbury 2).
O "A psychologist never saw a fact in his life. He only hears about feelings, vague things" (Bradbury 10).

Answers

Answer:

O "This house which clothed and fed and rocked them to sleep and played and sang as was good to them" (Bradbury 2).

Explanation:

Other Questions
a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives?